ID: 948420974_948420983

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 948420974 948420983
Species Human (GRCh38) Human (GRCh38)
Location 2:237859770-237859792 2:237859787-237859809
Sequence CCAGCCGGTGTCCTCTAGGGGAG GGGGAGAGGAGGGGAGCGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 90} {0: 2, 1: 11, 2: 320, 3: 3109, 4: 8625}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!