ID: 948420974_948420984

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 948420974 948420984
Species Human (GRCh38) Human (GRCh38)
Location 2:237859770-237859792 2:237859788-237859810
Sequence CCAGCCGGTGTCCTCTAGGGGAG GGGAGAGGAGGGGAGCGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 90} {0: 1, 1: 1, 2: 42, 3: 678, 4: 5424}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!