ID: 948421055_948421064

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 948421055 948421064
Species Human (GRCh38) Human (GRCh38)
Location 2:237860064-237860086 2:237860097-237860119
Sequence CCCCAGCCCCGCACCTCGTTTCT GCCGCGGTGACTGCCAGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 230} {0: 1, 1: 0, 2: 1, 3: 7, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!