ID: 948465296_948465310

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 948465296 948465310
Species Human (GRCh38) Human (GRCh38)
Location 2:238149199-238149221 2:238149242-238149264
Sequence CCTGACATCAGAGAGCCAGCCTG CACAGAGGGCCCACTGCGAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 24, 4: 255} {0: 1, 1: 0, 2: 1, 3: 10, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!