ID: 948470667_948470669

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 948470667 948470669
Species Human (GRCh38) Human (GRCh38)
Location 2:238175818-238175840 2:238175833-238175855
Sequence CCAGACTGGAGTGCAGTGGCTAT GTGGCTATTCACAGACATGGTGG
Strand - +
Off-target summary {0: 28, 1: 579, 2: 2469, 3: 24437, 4: 209516} {0: 1, 1: 0, 2: 1, 3: 18, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!