ID: 948487307_948487318

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 948487307 948487318
Species Human (GRCh38) Human (GRCh38)
Location 2:238289048-238289070 2:238289076-238289098
Sequence CCTTCCATTCACTACGCCCTCAA CCAGCTCGGGGAGCGCGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 114} {0: 1, 1: 0, 2: 0, 3: 13, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!