ID: 948601228_948601235

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 948601228 948601235
Species Human (GRCh38) Human (GRCh38)
Location 2:239108461-239108483 2:239108497-239108519
Sequence CCCTGCTGCAGCAGGCTGAGGAG GGAGGTCTGCCCTGGGTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 424} {0: 1, 1: 0, 2: 3, 3: 35, 4: 350}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!