ID: 948621002_948621017

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 948621002 948621017
Species Human (GRCh38) Human (GRCh38)
Location 2:239234672-239234694 2:239234719-239234741
Sequence CCTAAGCTCCCACGCAAACAGGC TCTGTGGGAGGCTGAAGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 113} {0: 1, 1: 0, 2: 4, 3: 50, 4: 623}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!