ID: 948632805_948632812

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 948632805 948632812
Species Human (GRCh38) Human (GRCh38)
Location 2:239312855-239312877 2:239312872-239312894
Sequence CCACGTTCCCCCAGTGTCTTCAT CTTCATCTGCAGAGGGAGACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 274} {0: 1, 1: 0, 2: 4, 3: 45, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!