|
Left Crispr |
Right Crispr |
Crispr ID |
948633832 |
948633842 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:239321186-239321208
|
2:239321220-239321242
|
Sequence |
CCAGGCGCAGTGGCTCACGCCTG |
CTTTGGAAGGTGAAGGTGGGCGG |
Strand |
- |
+ |
Off-target summary |
{0: 9533, 1: 58782, 2: 109662, 3: 131093, 4: 137784} |
{0: 5, 1: 125, 2: 2466, 3: 32371, 4: 113275} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|