ID: 948723344_948723347

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 948723344 948723347
Species Human (GRCh38) Human (GRCh38)
Location 2:239917348-239917370 2:239917379-239917401
Sequence CCAGCACTCCCTCAACATAGGGA ACAAATTTTCCTGTCTCTTATGG
Strand - +
Off-target summary {0: 19, 1: 37, 2: 31, 3: 22, 4: 129} {0: 1, 1: 6, 2: 9, 3: 64, 4: 412}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!