ID: 948751348_948751361

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 948751348 948751361
Species Human (GRCh38) Human (GRCh38)
Location 2:240135203-240135225 2:240135242-240135264
Sequence CCAGTCGGCATCCCCCAACCCAG GGCCTTCATCCCCCACTACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 172} {0: 1, 1: 0, 2: 0, 3: 22, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!