ID: 948815709_948815720

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 948815709 948815720
Species Human (GRCh38) Human (GRCh38)
Location 2:240509391-240509413 2:240509441-240509463
Sequence CCACTCCACAGCAGGTTAGGATT TATGTCCCTGGCACACTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 129} {0: 1, 1: 0, 2: 1, 3: 20, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!