ID: 948825223_948825233

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 948825223 948825233
Species Human (GRCh38) Human (GRCh38)
Location 2:240570711-240570733 2:240570759-240570781
Sequence CCTGCCCTGCAGCGTCTGGAGCC GCCCATCAGCACCTGTGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 300} {0: 1, 1: 0, 2: 4, 3: 28, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!