ID: 948826462_948826466

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 948826462 948826466
Species Human (GRCh38) Human (GRCh38)
Location 2:240575546-240575568 2:240575564-240575586
Sequence CCTGCTGGACTCCTTCCTGAGCT GAGCTTCTTCCCGGAGCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 293} {0: 1, 1: 0, 2: 2, 3: 15, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!