ID: 948868065_948868073

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 948868065 948868073
Species Human (GRCh38) Human (GRCh38)
Location 2:240785288-240785310 2:240785311-240785333
Sequence CCCACAGTGGCGTCCTCAGCCCC AGCCCTTGCTGGTATATTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 203} {0: 1, 1: 0, 2: 0, 3: 4, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!