ID: 948910262_948910279

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 948910262 948910279
Species Human (GRCh38) Human (GRCh38)
Location 2:240999130-240999152 2:240999177-240999199
Sequence CCGCCGCCGCCGCCAGCCACTTG TGAGGACAGCGCTTCCTCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 397} {0: 1, 1: 0, 2: 0, 3: 15, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!