ID: 948923808_948923815

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 948923808 948923815
Species Human (GRCh38) Human (GRCh38)
Location 2:241081391-241081413 2:241081426-241081448
Sequence CCCTCCTCCTTCTCCTCCTCCTT CTTCCTTCCTTCCAGTAATGAGG
Strand - +
Off-target summary {0: 8, 1: 107, 2: 842, 3: 2982, 4: 9946} {0: 1, 1: 0, 2: 6, 3: 29, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!