ID: 948931775_948931783

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 948931775 948931783
Species Human (GRCh38) Human (GRCh38)
Location 2:241136791-241136813 2:241136828-241136850
Sequence CCTCCGACGGTGGTTGCTGGGGA GGAGCTTGGCAGCCATGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 61} {0: 1, 1: 0, 2: 2, 3: 52, 4: 442}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!