ID: 948931775_948931784

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 948931775 948931784
Species Human (GRCh38) Human (GRCh38)
Location 2:241136791-241136813 2:241136829-241136851
Sequence CCTCCGACGGTGGTTGCTGGGGA GAGCTTGGCAGCCATGAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 61} {0: 1, 1: 1, 2: 3, 3: 63, 4: 449}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!