ID: 948945389_948945401

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 948945389 948945401
Species Human (GRCh38) Human (GRCh38)
Location 2:241216666-241216688 2:241216701-241216723
Sequence CCTACCACTGTCACCTTACCAGG CCAGGGGCTCACTGCCTGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 169} {0: 1, 1: 1, 2: 4, 3: 33, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!