ID: 948953191_948953196

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 948953191 948953196
Species Human (GRCh38) Human (GRCh38)
Location 2:241268440-241268462 2:241268480-241268502
Sequence CCAGGGACAGGAAGTCTTCAGAC CAAAACGGTCAGTAGCCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 176} {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!