ID: 948953200_948953208

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 948953200 948953208
Species Human (GRCh38) Human (GRCh38)
Location 2:241268508-241268530 2:241268533-241268555
Sequence CCTGAGGCCGCCTCTGTCAGCCT CAGCTTTTGCTGGTATGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 230} {0: 1, 1: 0, 2: 13, 3: 88, 4: 682}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!