ID: 948974283_948974292

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 948974283 948974292
Species Human (GRCh38) Human (GRCh38)
Location 2:241454025-241454047 2:241454059-241454081
Sequence CCACCCACCTCGGCCTCCCAAAG TAGCCATGAGTCACCGCACCCGG
Strand - +
Off-target summary {0: 27130, 1: 110883, 2: 157143, 3: 168159, 4: 124493} {0: 1, 1: 20, 2: 887, 3: 10420, 4: 48694}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!