|
Left Crispr |
Right Crispr |
Crispr ID |
948974283 |
948974292 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:241454025-241454047
|
2:241454059-241454081
|
Sequence |
CCACCCACCTCGGCCTCCCAAAG |
TAGCCATGAGTCACCGCACCCGG |
Strand |
- |
+ |
Off-target summary |
{0: 27130, 1: 110883, 2: 157143, 3: 168159, 4: 124493} |
{0: 1, 1: 20, 2: 887, 3: 10420, 4: 48694} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|