ID: 949007171_949007187

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 949007171 949007187
Species Human (GRCh38) Human (GRCh38)
Location 2:241656291-241656313 2:241656337-241656359
Sequence CCACGTCACCCGCGTCCCACGTC TGCTGCTCCCTCTGTCTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 87} {0: 1, 1: 1, 2: 10, 3: 122, 4: 1895}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!