ID: 949011156_949011162

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 949011156 949011162
Species Human (GRCh38) Human (GRCh38)
Location 2:241679329-241679351 2:241679363-241679385
Sequence CCTCCCACAGAGCCTGCGGCTCT CGCACAGCAGGAAGAAGCAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 21, 4: 229} {0: 1, 1: 0, 2: 4, 3: 26, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!