ID: 949014734_949014745

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 949014734 949014745
Species Human (GRCh38) Human (GRCh38)
Location 2:241702613-241702635 2:241702638-241702660
Sequence CCGCGGGGCGTCTCTCCCCGGCA GGGGACTGCGGCGCGGAGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 112} {0: 1, 1: 0, 2: 6, 3: 51, 4: 512}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!