ID: 949024663_949024670

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 949024663 949024670
Species Human (GRCh38) Human (GRCh38)
Location 2:241761211-241761233 2:241761241-241761263
Sequence CCAGGAATCGTAAGTAATCTAGA TAAAGTATACAGGAGGGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 60} {0: 3, 1: 6, 2: 19, 3: 45, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!