ID: 949106761_949106763

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 949106761 949106763
Species Human (GRCh38) Human (GRCh38)
Location 3:208775-208797 3:208797-208819
Sequence CCAAAAGTATTAAAAAATAAAAC CTGGAGACCTTGAATTATACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 18, 3: 309, 4: 2406} {0: 1, 1: 0, 2: 0, 3: 14, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!