ID: 949125662_949125667

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 949125662 949125667
Species Human (GRCh38) Human (GRCh38)
Location 3:443130-443152 3:443175-443197
Sequence CCAAAGCCCAGTAACAGGCAAAG AGTTATCTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 4, 1: 183, 2: 175, 3: 126, 4: 291} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!