ID: 949187190_949187194

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 949187190 949187194
Species Human (GRCh38) Human (GRCh38)
Location 3:1206334-1206356 3:1206376-1206398
Sequence CCCACATGCATCAGTGTATTTTC TGCCTTCCCTCCTGTTACTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 222} {0: 1, 1: 2, 2: 15, 3: 49, 4: 342}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!