ID: 949271504_949271511

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 949271504 949271511
Species Human (GRCh38) Human (GRCh38)
Location 3:2223196-2223218 3:2223249-2223271
Sequence CCTTTACTGTTCTAGGTGGACAA AGTTGCCCTGTGGGTGTCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 100} {0: 1, 1: 0, 2: 1, 3: 11, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!