ID: 949276163_949276164

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 949276163 949276164
Species Human (GRCh38) Human (GRCh38)
Location 3:2284343-2284365 3:2284360-2284382
Sequence CCAATCTATAGTATACATATCAA TATCAAAACTTAGCTTGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 557} {0: 1, 1: 0, 2: 0, 3: 4, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!