ID: 949312812_949312817

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 949312812 949312817
Species Human (GRCh38) Human (GRCh38)
Location 3:2719418-2719440 3:2719457-2719479
Sequence CCAAGTAGCTGGGACTGCAGGAA GCTGATTTTTTAGCAGAGACAGG
Strand - +
Off-target summary {0: 16, 1: 1754, 2: 41805, 3: 171761, 4: 173282} {0: 1, 1: 5, 2: 71, 3: 468, 4: 10636}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!