ID: 949331621_949331633

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 949331621 949331633
Species Human (GRCh38) Human (GRCh38)
Location 3:2929941-2929963 3:2929985-2930007
Sequence CCATGCCAGGGCAGGGATCCCCA TCCCTGGTTACTAATAATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 307} {0: 1, 1: 0, 2: 3, 3: 16, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!