ID: 949354425_949354431

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 949354425 949354431
Species Human (GRCh38) Human (GRCh38)
Location 3:3163221-3163243 3:3163259-3163281
Sequence CCCTGTAGATAACCTGACGTATA TGTATCACCTAAAACCTTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 61} {0: 1, 1: 0, 2: 4, 3: 17, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!