ID: 949409927_949409932

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 949409927 949409932
Species Human (GRCh38) Human (GRCh38)
Location 3:3752738-3752760 3:3752790-3752812
Sequence CCTCCAGGATTAGCATTGCTAAT TTGGGTCTCCCACATCATTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 103} {0: 1, 1: 0, 2: 4, 3: 16, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!