ID: 949417590_949417595

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 949417590 949417595
Species Human (GRCh38) Human (GRCh38)
Location 3:3830867-3830889 3:3830912-3830934
Sequence CCAAAGCCTAGTAACAGGCCAAG AGTTATCTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 11, 1: 179, 2: 168, 3: 103, 4: 183} {0: 185, 1: 187, 2: 104, 3: 111, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!