ID: 949445608_949445613

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 949445608 949445613
Species Human (GRCh38) Human (GRCh38)
Location 3:4131024-4131046 3:4131063-4131085
Sequence CCTGCCATCTTCTGCAGATAACT ACAGCTCTTGGCCTGTTACTGGG
Strand - +
Off-target summary {0: 185, 1: 187, 2: 104, 3: 111, 4: 225} {0: 174, 1: 194, 2: 145, 3: 123, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!