ID: 949477737_949477744

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 949477737 949477744
Species Human (GRCh38) Human (GRCh38)
Location 3:4465174-4465196 3:4465218-4465240
Sequence CCTTAGAAAGAGGGACAGACTGG TGTAATCCCAGCACGCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 253} {0: 79, 1: 9616, 2: 306293, 3: 267125, 4: 207534}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!