ID: 949480974_949480986

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 949480974 949480986
Species Human (GRCh38) Human (GRCh38)
Location 3:4493540-4493562 3:4493575-4493597
Sequence CCAGCGGCTGCTAACCCCTCTCC CCCAAACCGGCGTGGCTCCCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 166} {0: 1, 1: 0, 2: 1, 3: 6, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!