ID: 949500388_949500390

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 949500388 949500390
Species Human (GRCh38) Human (GRCh38)
Location 3:4674671-4674693 3:4674716-4674738
Sequence CCTTGTTACTTCTGAGTTAACAA TTTTAAGAGCTGTATTGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 185} {0: 1, 1: 1, 2: 2, 3: 17, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!