ID: 949637635_949637640

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 949637635 949637640
Species Human (GRCh38) Human (GRCh38)
Location 3:6000760-6000782 3:6000790-6000812
Sequence CCTGATACTTTTCAGTGCCAAGC TTTTTGGTGACATCTTCTGTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!