ID: 949707766_949707768

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 949707766 949707768
Species Human (GRCh38) Human (GRCh38)
Location 3:6838609-6838631 3:6838634-6838656
Sequence CCTGTCTTTTCTAATAAATCTGC TTCTTCGCCCATGACTGTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 333} {0: 1, 1: 0, 2: 10, 3: 18, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!