ID: 949774711_949774714

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 949774711 949774714
Species Human (GRCh38) Human (GRCh38)
Location 3:7619737-7619759 3:7619753-7619775
Sequence CCAATGGAATGCATATCTGATAA CTGATAAAGAAGTTGGGACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 152} {0: 1, 1: 0, 2: 3, 3: 13, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!