ID: 949860982_949860985

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 949860982 949860985
Species Human (GRCh38) Human (GRCh38)
Location 3:8504504-8504526 3:8504541-8504563
Sequence CCCACCAACTGGAAAGTCATAAA AGAACATAAAATCTAAAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 333} {0: 1, 1: 0, 2: 5, 3: 83, 4: 878}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!