ID: 949878240_949878243

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 949878240 949878243
Species Human (GRCh38) Human (GRCh38)
Location 3:8641133-8641155 3:8641153-8641175
Sequence CCAAAGCCTGCCTGAGTGCGGCT GCTCCCTGTCCTGTGCCCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 126} {0: 1, 1: 0, 2: 5, 3: 41, 4: 411}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!