ID: 949905266_949905273

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 949905266 949905273
Species Human (GRCh38) Human (GRCh38)
Location 3:8853487-8853509 3:8853526-8853548
Sequence CCTCTAGATCACCATGGGGCCCC TTGCTTTGTGAGACCCTGAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 87} {0: 1, 1: 0, 2: 2, 3: 24, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!