ID: 949908775_949908785

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 949908775 949908785
Species Human (GRCh38) Human (GRCh38)
Location 3:8882550-8882572 3:8882591-8882613
Sequence CCCGGCTGTTTCCCACCATCAGC CAGGAGCAGGAAATGGCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 267} {0: 1, 1: 0, 2: 3, 3: 36, 4: 395}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!