ID: 949916163_949916166

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 949916163 949916166
Species Human (GRCh38) Human (GRCh38)
Location 3:8966254-8966276 3:8966277-8966299
Sequence CCATGCCTTAGTAAAAAGTTCAG ATTTTAATCCATGTTAACTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 25, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!